Articles of algoritmo de

¿Cómo aprendo algoritmos?

Breve historia: recién me gradué de la escuela secundaria, aprendí un poco de python y C ++, no tengo amigos con ningún conocimiento informático útil. De todos los que conocí en mis años escolares, probablemente era el mayor nerd, pero nadie lo sabía. Me considero que tengo una gran cantidad de conocimientos sobre computadoras y […]

Determinar el casco no convexo de la colección de segmentos de línea

Tengo un problema de geometría computacional que creo que debería tener una solución relativamente simple, pero no puedo resolverlo del todo. Necesito determinar el contorno no convexo de una región definida por varios segmentos de línea. Soy consciente de varios algoritmos de casco no convexo (por ejemplo, formas alfa), pero no necesito un algoritmo completamente […]

Algoritmo (resolución de problemas) logrando el tiempo de ejecución más rápido

Para un entrenamiento de competición de algoritmos (no tareas) nos dieron esta pregunta de un año pasado. Lo publiqué en este sitio porque el otro sitio requería un inicio de sesión. Este es el problema: http://pastehtml.com/view/c5nhqhdcw.html La imagen no funcionó, así que la publicamos aquí: Tiene que ejecutarse en menos de un segundo y solo […]

El tutorial de imágenes de Python funciona, otras imágenes se comportan de manera diferente (mostrando imágenes con Pylab)

Acabo de empezar a experimentar con Python y el procesamiento de imágenes. Seguí este tutorial muy bien estructurado: http://pythonvision.org/basic-tutorial/ . Todo en el tutorial parece funcionar, con la imagen provista (la que tiene las celdas). Ahora quería probar cómo se comporta esto al ingresar otra imagen. Así que tomé otra imagen (la que está al […]

Algoritmo más eficiente para búsqueda de supercuerdas más cortas

Mi problema a continuación es NP-completo, sin embargo, estoy tratando de encontrar al menos una función o módulo de búsqueda de cadenas ligeramente más rápido que pueda ayudar a reducir parte del tiempo de cálculo en comparación con la ubicación actual. Cualquier sugerencia sera apreciada. La supercuerdas concatenadas (la más larga posible) es: AGGAGTCCGCGTGAGGGAGGTGTAGTGTAGTGG El […]

Implementación Python del intervalo de puntuación de Wilson?

Después de leer Cómo no ordenar por calificación promedio , sentí curiosidad por si alguien tiene una implementación en Python de un intervalo de confianza del límite inferior de Wilson para un parámetro Bernoulli

Estructura de datos hash subyacente de Python para diccionarios

Estoy construyendo un diccionario muy grande y estoy realizando muchas comprobaciones para ver si una clave está en la estructura y luego la agrego si es única o si incrementa el contador si es idéntica. Python utiliza una estructura de datos hash para almacenar diccionarios (no debe confundirse con una función criptográfica de hash). Las […]

Algoritmo de fuerza bruta de Python

Necesito generar cada combinación posible de un conjunto de caracteres dado a un rango dado. Me gusta, charset=list(map(str,”abcdefghijklmnopqrstuvwxyz”)) range=10 Y la salida debe ser, [a,b,c,d………………,zzzzzzzzzy,zzzzzzzzzz] Sé que puedo hacer esto usando bibliotecas ya en uso. Pero necesito saber cómo funcionan realmente. Si alguien me puede dar un código comentado de este tipo de algoritmo en […]

Python – Acelera un algoritmo de búsqueda de estrellas A

He codificado mi primer algoritmo ligeramente complejo, una implementación del algoritmo A Star Pathfinding . Seguí algunos consejos de Python.org sobre la implementación de gráficos para que un diccionario contenga todos los nodos a los que también está vinculado cada nodo. Ahora, ya que esto es todo para un juego, cada nodo es en realidad […]

Cálculo de la complejidad de Levenshtein Editar distancia

He estado observando esta sencilla implementación en Python de Levenshtein Edit Distance para todo el día. def lev(a, b): “””Recursively calculate the Levenshtein edit distance between two strings, a and b. Returns the edit distance. “”” if(“” == a): return len(b) # returns if a is an empty string if(“” == b): return len(a) # […]