Articles of awk

procesar texto desde un archivo no plano (para extraer información como si * fuera * un archivo plano)

Tengo un conjunto de datos longitudinales generado por una simulación por computadora que puede representarse mediante las siguientes tablas (‘var’ son variables): time subject var1 var2 var3 t1 subjectA … t2 subjectB … y subject name subjectA nameA subjectB nameB Sin embargo, el archivo generado escribe un archivo de datos en un formato similar al […]

Bash script para seleccionar una sola función de Python de un archivo

Para un problema de alias de git , me gustaría poder seleccionar una sola función de Python de un archivo, por nombre. p.ej: … def notyet(): wait for it def ok_start(x): stuff stuff def dontgettrickednow(): keep going #stuff more stuff def ok_stop_now(): En términos algorítmicos, lo siguiente sería lo suficientemente cerca: Comience a filtrar cuando […]

¿Cómo ejecutar awk -F \ ” {print $ 2} ‘dentro de subprocess.Popen en Python?

Necesito ejecutar un comando de shell dentro de subprocess.Popen en Python. El comando es: $ virsh dumpxml server1 | grep ‘archivo fuente’ | awk -F \ ” {imprimir $ 2} ‘ La salida es: /vms/onion.qcow2 Estoy teniendo dos desafíos con el comando anterior: 1) El comando está dentro de un bucle, y donde ve ‘server1’, […]

Combina líneas con teclas coincidentes

Tengo un archivo de texto con la siguiente estructura ID,operator,a,b,c,d,true WCBP12236,J1,75.7,80.6,65.9,83.2,82.1 WCBP12236,J2,76.3,79.6,61.7,81.9,82.1 WCBP12236,S1,77.2,81.5,69.4,84.1,82.1 WCBP12236,S2,68.0,68.0,53.2,68.5,82.1 WCBP12234,J1,63.7,67.7,72.2,71.6,75.3 WCBP12234,J2,68.6,68.4,41.4,68.9,75.3 WCBP12234,S1,81.8,82.7,67.0,87.5,75.3 WCBP12234,S2,66.6,67.9,53.0,70.7,75.3 WCBP12238,J1,78.6,79.0,56.2,82.1,84.1 WCBP12239,J2,66.6,72.9,79.5,76.6,82.1 WCBP12239,S1,86.6,87.8,23.0,23.0,82.1 WCBP12239,S2,86.0,86.9,62.3,89.7,82.1 WCBP12239,J1,70.9,71.3,66.0,73.7,82.1 WCBP12238,J2,75.1,75.2,54.3,76.4,84.1 WCBP12238,S1,65.9,66.0,40.2,66.5,84.1 WCBP12238,S2,72.7,73.2,52.6,73.9,84.1 Cada ID corresponde a un conjunto de datos que un operador analiza varias veces. es decir, J1 y J2 son el primer y segundo bash del operador J. Las […]

Coincidencia de expresiones regulares de múltiples líneas en AWK. && operador?

No estoy seguro si el operador de && trabaja en expresiones regulares. Lo que estoy tratando de hacer es hacer coincidir una línea de manera que comience con un número y tenga la letra ‘a’ Y la siguiente línea comience con un número y tenga la letra ‘b’ Y la siguiente línea … letra ‘c’ […]

Expresión regular: reemplaza todos los espacios al principio de la línea con puntos

No me importa si lo logro a través de vim, sed, awk, python, etc. Lo intenté en todo, no pude hacerlo. Para una entrada como esta: top f1 f2 f3 sub1 f1 f2 f3 sub2 f1 f2 f3 sub21 f1 f2 f3 sub3 f1 f2 f3 Quiero: top f1 f2 f3 …sub1 f1 f2 f3 […]

Eliminar las comillas en el campo en el archivo csv

Digamos que tenemos un archivo separado por comas (csv) como este: “name of movie”,”starring”,”director”,”release year” “dark knight rises”,”christian bale, anna hathaway”,”christopher nolan”,”2012″ “the dark knight”,”christian bale, heath ledger”,”christopher nolan”,”2008″ “The “day” when earth stood still”,”Michael Rennie,the ‘strong’ man”,”robert wise”,”1951″ “the ‘gladiator'”,”russel “the awesome” crowe”,”ridley scott”,”2000″ Como puede ver desde arriba, en las líneas 4 y […]

Almacenamiento de valor de un ping analizado

Estoy trabajando en algún código que realiza una operación de ping desde python y extrae solo la latencia mediante el uso de awk. Esto es actualmente lo que tengo: from os import system l = system(“ping -c 1 sitename | awk -F = ‘FNR==2 {print substr($4,1,length($4)-3)}'”) print l La llamada al system() funciona bien, pero […]

Creando múltiples archivos csv a partir de datos dentro de un archivo csv

Sistema OSX o Linux Estoy tratando de automatizar mi flujo de trabajo en el trabajo, cada semana recibo un archivo de Excel, que convierto a csv. Un ejemplo es: ,,L1,,,L2,,,L3,,,L4,,,L5,,,L6,,,L7,,,L8,,,L9,,,L10,,,L11, Title,r/t,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,neede d,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst EXAMPLEfoo,60,6,6,6,0,0,0,0,0,0,6,6,6,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLEbar,30,6,6,12,6,7,14,6,6,12,6,6,12,6,8,16,6,7,14,6,7.5,15,6,6,12,6,8,16,6,0,0,6,7,14 EXAMPLE1,60,3,3,3,3,5,5,3,4,4,3,3,3,3,6,6,3,4,4,3,3,3,3,4,4,3,8,8,3,0,0,3,4,4 EXAMPLE2,120,6,6,3,0,0,0,6,8,4,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLE3,60,6,6,6,6,8,8,6,6,6,6,6,6,0,0,0,0,0,0,6,8,8,6,6,6,0,0,0,0,0,0,0,10,10 EXAMPLE4,30,6,6,12,6,7,14,6,6,12,6,6,12,3,5.5,11,6,7.5,15,6,6,12,6,0,0,6,9,18,6,0,0,6,6.5,13 Y así puede obtener una imagen de cómo se ve en excel: texto alt http://sofes.miximages.com/python/2dt2glt.png Lo que […]

extraer cada dato de secuenciación como archivo individual

Hay un archivo ecoli.ffn con filas que indican el nombre de los genes de secuenciación: $head ecoli.ffn >ecoli16:g027092:GCF_000460315:gi|545267691|ref|NZ_KE701669.1|:551259-572036 ATGAGCCTGATTATTGATGTTATTTCGCGT AAAACATCCGTCAAACAAACGCTGATTAAT >ecoli16:g000011:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT >ecoli16:g000012:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT CTGACAGCTGTTCTTACACTGGATTCAACC CTGACAGCTGTTCTTACACTGGATTCAACC Como se muestra arriba, el nombre del gen se encuentra entre el primer y segundo colon: g027092 g000011 g000012 Me gustaría usar ecoli.ffn para generar tres archivos: g027092.txt , […]