Articles of bash

automatizar el script de shell para iniciar sesión vpn pasando sudo -S

Tengo que volver a iniciar sesión en mi VPN cada vez que salgo de mi escritorio, y es tedioso. Estoy tratando de pasarle la información a la shell, pero no la consigo en el orden correcto. El orden es “intente establecer una conexión, ingrese sudo pw si es necesario, luego nombre de usuario, luego contraseña”. […]

Ejecutando un script de bash desde Python

Necesito ejecutar un script de bash desde Python. Lo tengo para trabajar de la siguiente manera: import os os.system(“xterm -hold -e scipt.sh”) Eso no es exactamente lo que estoy haciendo, sino más bien la idea. Eso funciona bien, se abre una nueva ventana de terminal y la mantengo con fines de depuración, pero mi problema […]

Ejecutando progtwig python

He estado buscando en la web una respuesta desde hace bastante tiempo, pero esto me está causando un gran dolor de cabeza: Estoy usando Ubuntu 12.04 y quiero ejecutar un script de Python desde el terminal sin usar la ruta completa. Así que agregué / home / kyril / python / scripts / a la […]

¿Cómo filtrar solo los caracteres imprimibles en un archivo en Bash (linux) o Python?

Quiero hacer un archivo que incluya caracteres no imprimibles para incluir solo caracteres imprimibles. Creo que este problema está relacionado con la acción de control ACSCII , pero no pude encontrar una solución para hacerlo y tampoco pude entender el significado de .[16D (¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿¿ HEXDUMP DEL ARCHIVO DE ENTRADA: 00000000: 4845 4c4c 4f20 5448 4953 […]

Creando múltiples archivos csv a partir de datos dentro de un archivo csv

Sistema OSX o Linux Estoy tratando de automatizar mi flujo de trabajo en el trabajo, cada semana recibo un archivo de Excel, que convierto a csv. Un ejemplo es: ,,L1,,,L2,,,L3,,,L4,,,L5,,,L6,,,L7,,,L8,,,L9,,,L10,,,L11, Title,r/t,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,neede d,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst EXAMPLEfoo,60,6,6,6,0,0,0,0,0,0,6,6,6,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLEbar,30,6,6,12,6,7,14,6,6,12,6,6,12,6,8,16,6,7,14,6,7.5,15,6,6,12,6,8,16,6,0,0,6,7,14 EXAMPLE1,60,3,3,3,3,5,5,3,4,4,3,3,3,3,6,6,3,4,4,3,3,3,3,4,4,3,8,8,3,0,0,3,4,4 EXAMPLE2,120,6,6,3,0,0,0,6,8,4,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLE3,60,6,6,6,6,8,8,6,6,6,6,6,6,0,0,0,0,0,0,6,8,8,6,6,6,0,0,0,0,0,0,0,10,10 EXAMPLE4,30,6,6,12,6,7,14,6,6,12,6,6,12,3,5.5,11,6,7.5,15,6,6,12,6,0,0,6,9,18,6,0,0,6,6.5,13 Y así puede obtener una imagen de cómo se ve en excel: texto alt http://sofes.miximages.com/python/2dt2glt.png Lo que […]

¿Cómo implementar subprocesos para ejecutar dos comandos de shell bash en python?

Tengo que grabar un archivo wav y al mismo tiempo tengo que analizarlo con sox. Estoy usando el archivo de tipo fifo para esta operación. Así que aquí necesito comenzar 2 hilos al mismo tiempo, pero incluso si uso los hilos no puedo lograr lo que quiero hacer. Siempre uno ejecutando primero y luego el […]

Script para encontrar duplicados en un archivo csv

Tengo un archivo csv de 40 MB con 50,000 registros. Es un listado de productos gigantes. Cada fila tiene cerca de 20 campos. [Artículo #, UPC, Desc, etc] Cómo puedo, a) Encuentra e imprime filas duplicadas. [Este archivo es un gran archivo adjunto, así que tengo varios encabezados incluidos en el archivo que necesito eliminar, […]

extraer cada dato de secuenciación como archivo individual

Hay un archivo ecoli.ffn con filas que indican el nombre de los genes de secuenciación: $head ecoli.ffn >ecoli16:g027092:GCF_000460315:gi|545267691|ref|NZ_KE701669.1|:551259-572036 ATGAGCCTGATTATTGATGTTATTTCGCGT AAAACATCCGTCAAACAAACGCTGATTAAT >ecoli16:g000011:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT >ecoli16:g000012:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT CTGACAGCTGTTCTTACACTGGATTCAACC CTGACAGCTGTTCTTACACTGGATTCAACC Como se muestra arriba, el nombre del gen se encuentra entre el primer y segundo colon: g027092 g000011 g000012 Me gustaría usar ecoli.ffn para generar tres archivos: g027092.txt , […]

Ubuntu 11.10 + error Bash + Python + instalación Python no válida

File “/usr/lib/python2.7/site.py”, line 562, in main() File “/usr/lib/python2.7/site.py”, line 544, in main known_paths = addusersitepackages(known_paths) File “/usr/lib/python2.7/site.py”, line 271, in addusersitepackages user_site = getusersitepackages() File “/usr/lib/python2.7/site.py”, line 246, in getusersitepackages user_base = getuserbase() # this will also set USER_BASE File “/usr/lib/python2.7/site.py”, line 236, in getuserbase USER_BASE = get_config_var(‘userbase’) File “/usr/lib/python2.7/sysconfig.py”, line 543, in get_config_var return […]

La mejor manera de interactuar con un servicio con fines de explotación.

Supongamos que tengo un servicio para interactuar. Usando netcat sería algo como esto: > nc 127.0.0.1 8080 hello hi how are you? Quiero automatizar la interacción con este servicio para realizar algún ataque, por ejemplo, cadena de formato. Así que creo un script en Python y eso fue realmente doloroso para que funcionara. Aquí está […]