Articles of biopython

Cómo descargar la secuencia completa del genoma en biopython entrez.esearch

Tengo que descargar solo secuencias completas del genoma del formato NCBI (GenBank (completo)). Estoy interesado en el ‘genoma completo’ no en el ‘genoma completo’. mi guión: from Bio import Entrez Entrez.email = “asiakXX@wp.pl” gatunek=’Escherichia[ORGN]’ handle = Entrez.esearch(db=’nucleotide’, term=gatunek, property=’complete genome’ )#title=’complete genome[title]’) result = Entrez.read(handle) Como resultado, solo obtengo pequeños fragmentos de genomas, con un […]

Biopython: ¿Cómo evitar secuencias de aminoácidos particulares de una proteína para trazar el gráfico de Ramachandran?

He escrito una secuencia de comandos de python para trazar el ‘Diagtwig de Ramachandran’ de la proteína ubiquitina. Estoy usando biopython. Estoy trabajando con archivos pdb. Mi guión es el siguiente: import Bio.PDB import numpy as np import matplotlib as mpl import matplotlib.pyplot as plt phi_psi = ([0,0]) phi_psi = np.array(phi_psi) pdb1 =’/home/devanandt/Documents/VMD/1UBQ.pdb’ for model […]

Phylo BioPython construyendo árboles

Estoy tratando de construir un árbol con BioPython, módulo Phylo. Lo que he hecho hasta ahora es esta imagen: cada nombre tiene un número de cuatro dígitos seguido de – y un número: este número se refiere al número de veces que se representa esa secuencia. Eso significa 1578-22, ese nodo debe representar 22 secuencias. […]

Extraiga secuencias de un archivo FASTA basándose en entradas en un archivo separado

Tengo dos archivos. Archivo 1: un archivo FASTA con secuencias de genes, con este formato: >PITG_00002 | Phytophthora infestans T30-4 conserved hypothetical protein (426 nt) ATGCATCGCTCGGGTTCCGCACGGAAAGCCCAAGGTCTGGGATTACGGGGTGGTGGTCGG TTACACTTGGAATAACCTCGCAAATTCAGAATCTCTACAGGCTACGTTCGCGGATGGAAC >PITG_00003 | Phytophthora infestans T30-4 protein kinase (297 nt) ATGACGGCTGGGGTCGGTACGCCCTACTGGATCGCACCGGAGATTCTTGAAGGCAAACGG TACACTGAGCAAGCGGATATTTACTCGTTCGGAGTGGTTTTATCCGAGCTGGACACGTGC AAGATGCCGTTCTCTGACGTCGTTACGGCAGAGGGAAAGAAACCCAAACCAGTTCAGATC >PITG_00004 | Phytophthora infestans T30-4 protein kinase, putative (1969 nt) ATGCGCGTGTCTGGTCTCCTTTCAATTCTTGCAGCCACTTTGACCACGGCCCAAGACTAC Archivo 2: Un archivo de […]

Cálculo de la distancia entre coordenadas atómicas.

Tengo un archivo de texto como se muestra a continuación ATOM 920 CA GLN A 203 39.292 -13.354 17.416 1.00 55.76 C ATOM 929 CA HIS A 204 38.546 -15.963 14.792 1.00 29.53 C ATOM 939 CA ASN A 205 39.443 -17.018 11.206 1.00 54.49 C ATOM 947 CA GLU A 206 41.454 -13.901 10.155 […]

Rastreo en el algoritmo Smith-Wateman con penalización por brecha afín

Estoy intentando implementar el algoritmo de Smith-Waterman para la alineación de la secuencia local utilizando la función de penalización de espacio afín. Creo que entiendo cómo iniciar y calcular las matrices requeridas para calcular las puntuaciones de alineación, pero no tengo ni idea de cómo rastrear para encontrar la alineación. Para generar las 3 matrices […]

¿Cómo configuro PYTHONPATH en Cygwin?

En las instrucciones de instalación de Biopython, se dice que si Biopython no funciona, se supone que debo hacer esto: export PYTHONPATH = $ PYTHONPATH ‘: / directory / where / you / put / Biopython’ Intenté hacer eso en Cygwin desde el directorio ~ usando el nombre del directorio Biopython (o todo lo demás […]

¿Cómo paso Biopython SeqIO.convert () sobre varios archivos en un directorio?

Estoy escribiendo un script de Python (versión 2.7) que cambiará cada archivo de entrada (formato .nexus) dentro del directorio especificado al formato .fasta. El módulo Biopython SeqIO.convert maneja la conversión perfectamente para archivos específicos individualmente, pero cuando bash automatizar el proceso sobre un directorio usando os.walk, no puedo pasar la ruta de acceso de cada […]

¿Cómo puedo combinar cadenas superpuestas en python?

Tengo algunas cuerdas, [‘SGALWDV’, ‘GALWDVP’, ‘ALWDVPS’, ‘LWDVPSP’, ‘WDVPSPV’] Estas cuerdas se superponen parcialmente entre sí. Si los superpones manualmente obtendrías: SGALWDVPSPV Quiero una forma de pasar de la lista de cadenas superpuestas a la cadena comprimida final en python. Siento que este debe ser un problema que alguien ya haya resuelto y estoy tratando de […]

Instalación de biopython – python 3.3 no encontrada en el registro

Estoy intentando instalar biopython para ejecutarse con Python 3.3 en una computadora con Windows7. He descargado el biopython ejecutable biopython-1.61.win32-py3.3-beta.exe. Sin embargo, cuando bash ejecutar el archivo ejecutable, aparece el mensaje “Se requiere Python versión 3.3, que no se encuentra en el registro“. La versión 3.3 de Python está presente en mi computadora. He estado […]