Articles of sed

Python – usando subproceso para llamar a sed?

Deseo llamar a sed desde python utilizando subproceso. El script que intenté usar está abajo. sin embargo, esto canaliza la salida de sed al terminal estándar. Parece que el operador ‘>’ no se reconoce dentro de mi statement subprocess.call. ¿Alguna sugerencia? import sys import os import subprocess files = os.listdir(sys.argv[1]) count = 0 for f […]

Inconsistencia entre las expresiones regulares sed y python

Pido disculpas si esto se publica en alguna parte, pero mi búsqueda superficial no encontró nada. Mientras hacía algo de progtwigción en Python, noté que el siguiente comando: re.sub(“a*((ab)*)b”, r”\1″, “aabb”) devuelve la cadena vacía. Pero un comando equivalente en sed: echo “aabb” | sed “s/a*\(\(ab\)*\)b/\1/” devuelve ab Para mí tiene sentido que la directiva […]

¿Encontrar (comando bash) no funciona con subproceso?

He cambiado el nombre de un nombre de clase css en varias plantillas (python-django). Sin embargo, los archivos css están ampliamente distribuidos en varios archivos en varios directorios. Tengo un fragmento de código Python para comenzar a cambiar el nombre del directorio raíz y luego renombrar recursivamente todos los archivos css. from os import walk, […]

El comando sed ejecutado usando os.system () o subprocess.call () deja el archivo csv sin un delimitador

Estoy ejecutando un script de Python que toma el volcado de CSV de una base de datos de Postgres y luego quiero evitar comillas dobles en todos estos archivos. Así que estoy usando sed para hacerlo. En mi código de Python: sed_for_quotes = ‘sed -is/\\”//g /home/ubuntu/PTOR/csvdata1/’+table+’.csv’ subprocess.call(sed_for_quotes, shell=True) El proceso se completa sin ningún error, […]

Expresión regular: reemplaza todos los espacios al principio de la línea con puntos

No me importa si lo logro a través de vim, sed, awk, python, etc. Lo intenté en todo, no pude hacerlo. Para una entrada como esta: top f1 f2 f3 sub1 f1 f2 f3 sub2 f1 f2 f3 sub21 f1 f2 f3 sub3 f1 f2 f3 Quiero: top f1 f2 f3 …sub1 f1 f2 f3 […]

Cómo obtener un XML plano para que las entidades externas se fusionen al nivel superior

Sé que este es un caso límite si realmente pertenece a stackoverflow o superusuario, pero como parece que hay bastantes preguntas de ‘código de edición’ aquí, lo estoy publicando en SO. Tengo una stack de archivos XML que alguien en su infinita sabiduría ha decidido explotar en varios archivos utilizando las tags, lo que hace […]

dividir una base de datos de texto grande (xyz) en x partes iguales

Quiero dividir una base de datos de texto grande (~ 10 millones de líneas). Puedo usar un comando como $ sed -i -e ‘4 s/(dB)//’ -e ‘4 s/Best\ unit/Best_Unit/’ -e ‘1,3 d’ ‘/cygdrive/c/ Radio Mobile/Output/TRC_TestProcess/trc_longlands.txt’ $ split -l 1000000 /cygdrive/P/2012/Job_044_DM_Radio_Propogation/Working/FinalPropogation/TRC_Longlands/trc_longlands.txt 1 La primera línea es limpiar la base de datos y la siguiente es dividirla, […]

Creando múltiples archivos csv a partir de datos dentro de un archivo csv

Sistema OSX o Linux Estoy tratando de automatizar mi flujo de trabajo en el trabajo, cada semana recibo un archivo de Excel, que convierto a csv. Un ejemplo es: ,,L1,,,L2,,,L3,,,L4,,,L5,,,L6,,,L7,,,L8,,,L9,,,L10,,,L11, Title,r/t,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,neede d,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst,needed,actual,Inst EXAMPLEfoo,60,6,6,6,0,0,0,0,0,0,6,6,6,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLEbar,30,6,6,12,6,7,14,6,6,12,6,6,12,6,8,16,6,7,14,6,7.5,15,6,6,12,6,8,16,6,0,0,6,7,14 EXAMPLE1,60,3,3,3,3,5,5,3,4,4,3,3,3,3,6,6,3,4,4,3,3,3,3,4,4,3,8,8,3,0,0,3,4,4 EXAMPLE2,120,6,6,3,0,0,0,6,8,4,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0 EXAMPLE3,60,6,6,6,6,8,8,6,6,6,6,6,6,0,0,0,0,0,0,6,8,8,6,6,6,0,0,0,0,0,0,0,10,10 EXAMPLE4,30,6,6,12,6,7,14,6,6,12,6,6,12,3,5.5,11,6,7.5,15,6,6,12,6,0,0,6,9,18,6,0,0,6,6.5,13 Y así puede obtener una imagen de cómo se ve en excel: texto alt http://sofes.miximages.com/python/2dt2glt.png Lo que […]

extraer cada dato de secuenciación como archivo individual

Hay un archivo ecoli.ffn con filas que indican el nombre de los genes de secuenciación: $head ecoli.ffn >ecoli16:g027092:GCF_000460315:gi|545267691|ref|NZ_KE701669.1|:551259-572036 ATGAGCCTGATTATTGATGTTATTTCGCGT AAAACATCCGTCAAACAAACGCTGATTAAT >ecoli16:g000011:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT >ecoli16:g000012:55989:gi|218693476|ref|NC_011748.1|:1128430-1131042 GTGTACGCTATGGCGGGTAATTTTGCCGAT CTGACAGCTGTTCTTACACTGGATTCAACC CTGACAGCTGTTCTTACACTGGATTCAACC Como se muestra arriba, el nombre del gen se encuentra entre el primer y segundo colon: g027092 g000011 g000012 Me gustaría usar ecoli.ffn para generar tres archivos: g027092.txt , […]

Usando pysed en script

Puedo ejecutarlo exitosamente en la línea de comandos pero tengo problemas en el script de Python. Se queja de la segunda doble cita. pysed -r “192.168.33.10” “$NEW_IP” FILE –write ^ SyntaxError: invalid syntax ¿Cómo puedo ejecutar esto dentro de un script?